NestedAlign

NestedAlign
Varna

NESTEDALIGN

Sequence and Structure

Dot-parentheses format (also known as dot-bracket format)

Default format. In this format, the sequence is given first. Then, the structure is given, with matching parentheses ( and ) denoting a base pair, and a dot denoting an unpaired base.
Example :

> rna1
GGCAUUCC
((....))

BPseq format

The bpseq format is a simple text format in which there is one line per base in the molecule, listing the the position of the base (leftmost position is 1), the base name (A,C,G,U, or other alphabetical characters), and the position number of the base to which it is paired, with a 0 denoting that the base is unpaired.
For example, the structure represented in dot-parentheses format above would be represented in bpseq format as follows :

Filename: rna1.bpseq
Organism: Unknown
Accession Number: 000000
Citation and related information available at ?
1 G 8
2 G 7
3 C 0
4 A 0
5 U 0
6 U 0
7 C 2
8 C 1

N.B.: "Filename", "Organism", "Accession Number" and "Citation and related information available at ?" fields are required.

CT format

The first line contains the sequence length L (which can be followed by the name of the molecule). There are L subsequent lines, one per nucleotide. The ith line starts with i, then the letter denoting the ith nucleotide, then the 5'-connecting base index (i-1), then the 3' connecting base index (i+1), then the paired base index (or 0 if unpaired), and finally base index in the original sequence.
For example, the structure represented in bpseq format above would be represented in ct format as follows :

 8 RNA.1
 1  G  0  2  8  1
 2  G  1  3  7  2
 3  C  2  4  0  3
 4  A  3  5  0  4
 5  U  4  6  0  5
 6  U  5  7  0  6
 7  C  6  8  2  7
 8  C  7  0  1  8

It's possible to load two different formats for one comparison.

Alignement

Algnment mode options :

By default, global alignment.
Local alignment
Small-in-large alignment.

Score

NestedAlign has a default "light" score matrix.

But it's possible to choose two other score matrix types :

"Light" type matrix choosen by the user. The matrix file contains 12 floating numbers, which are given the ones under the others. Example : -10.0 1.0 0.0 -25.0 10.0 10.0 10.0 -3.0 -4.0 -5.0 -14.0 -15.0 This numbers respectively corresponds to the score for the following operations :
- Score for the deletion or the insertion of an unpaired base
- Score for the conservation of an unpaired base
- Score for the substitution of an unpaired base with an other
- Score for the deletion or the insertion base pair
- Score for the conservation of a base pair
- Score for the substitution of a base in a base pair
- Score for the total substitution of a base pair
- Score for a pair splitting into two unpaired bases or the fusion of two unpaired bases into a base pair, without substitution
- Score for a splitting or a fusion with a base substitution
- Score for the scission or the fusion with two bases substitutions
- Score for left or right alteration of a pair in an unpaired base or for left or right completion of an unpaired in a base pair, without substitution
- Score for the alteration or completion with substitution

"Full" matrix type, choosen by the user.The matrix file is organise in 7 matrix.

VARNA

Options

Open

Open from a dot-bracket manual input via 'Open->User input' or 'M' shortcut. Inputs could also be done from a DBN, BPSEQ or CT file with 'Open->file'.

Shortcut keys

Shortcut	Description	Available with modification off
1	Redraw with radiate algorithm	yes
2	Redraw with circular algorithm	yes
3	Redraw with NAView algorithm	yes
D	Color dash bases (-)	yes
F	Full screen view	yes
M	Manual input
O	Open file
P	Print the RNA	yes
R	Reset the view	yes
S	Color special bases (non A,C,G,U,-)	yes
T	Set title

Script options

Résumé

Param name	Value format/type	Description	Since version
`algorithm`	String (e.g. "radiate")	Sets the layout algorithm to be used for initial placement. As of version 1.0, valid values for this options are `radiate` (Tree-like structure) and `circular` (Circular Feynman's diagrams)	1.0
`applyBasesStyle`	String	See `basesStyle` description	3.0
`backbone`	Color (e.g. #00FF00)	Sets the color used to draw the bonds involved in the backbone	1.0
`background`	Color (e.g. #8FFF00)	Sets the background color	1.0
`baseInner`	Color (e.g. #00FFFF)	Sets the color used to fill the disc on top of which the nucleotide is drawn	1.0
`baseName`	Color (e.g. #F0FF0F)	Sets the color used to draw the nucleotide name	1.0
`baseNum`	Color (e.g. #FF0000)	Sets the color used to draw the nucleotide number	1.0
`baseOutline`	Color (e.g. #808080)	Sets the color used to draw the outer circle around the nucleotide	1.0
`basesStyle`	String	See `applyBasesStyle` description	3.0
`bp`	Color (e.g. #60A080)	Sets the color used to draw the base-pairings (hydrogen bonds)	1.0
`columns`	integer	Sets the number of columns in a multipanel layout	1.0
`comparisonMode`	boolean	Sets the applet in comparison mode if `true`. `false` by default	3.0
`error`	boolean	Shows varna errors if `true`. `true` by default.	3.0
`modifiable`	boolean	allow the user to modify the arn display if `true`. `true` by default.	3.0
`periodNum`	integer	Sets the numbering period. Nucleotide numbers will be printed for each base whose position is a multiple of the period n. First nucleotide number is always displayed to provide a frame of reference.	1.0
`rows`	integer	Sets the number of rows in a multipanel layout	1.0
`sequenceDBN`	String (e.g. "GGAGUCC")	Sets the raw nucleotide sequence for the displayed RNA. Each base must be encoded in a single character. Letters additional to [A,C,G,U] are tolerated	1.0
`structureDBN`	String (e.g. "((...))")	Sets the secondary structure of the displayed RNA in Dot-Bracket Notation (DBN). Valid structures in DBN format are well-parenthesized words consisting of dots '.', opening '(' and closing ')' parentheses. Dotted positions will be unpaired, whereas matching parenthesized positions will represent base-pairing nucleotides.	1.0
`title`	String (e.g. "MyRNA")	Sets the title of the displayed RNA. If set to the empty string `""`, does not display any title, leaving some extra room for the drawings	1.0
`titleColor`	Color (e.g. #204060)	Sets the color used to display the title	1.0
`titleSize`	integer	Sets the font size used to display the title	1.0
`warning`	boolean	Shows varna warnings if `true`. `false` by default.	3.0
`zoom`	double	Sets the zoom in used	3.0
`zoomAmount`	double	Sets the zoom amount in used	3.0

Bases Style

basesStyle creates a new style for bases, it defines the outline, the innerline, the name and the associate number color via these parameters:
basesOutlineColor, basesInnerColor, basesNameColor, basesNumbersColor.
Examples:

`1`	`<param name="basesStyle0" value="basesOutlineColor=#000000, basesInnerColor=#0000FF, basesNameColor=#00FF00, basesNumbersColor=#FF0000"/>`
`2`	`<param name="basesStyle1" value="basesInnerColor=#0000FF, basesNumbersColor=#FF0000"/>`
`3`	`<param name="basesStyle3" value="basesOutlineColor=#00FF00"/>`

Apply Bases Styles

applyBasesStyle applies an existing bases style on a list of bases (in only one panel in multiple panels case).
The parameter name means: applyBasesStyle[int: basesStyle number]on[int: panel number]
Examples:

`1`	`<param name="applyBasesStyle0on1" value="22, 23, 24, 114, 115, 116" />`
`2`	`<param name="applyBasesStyle1on1" value="27, 28, 29, 30, 67, 68, 69, 70"/>`
`3`	`<param name="applyBasesStyle0on2" value="10, 11, 12, 46, 47, 48"/>`
`4`	`<param name="applyBasesStyle3on3" value="54, 55, 56, 97, 98, 99"/>`

Demonstration

`1`	`<applet code="applis.VARNA"`
`2`	`codebase="bin"`
`3`	`archive="VARNA31.jar"`
`4`	`width="90%" height="600">`
`5`	`<param name="rows" value="1" />`
`6`	`<param name="columns" value="2" />`
`7`	`<param name="sequenceDBN1" value="CCAGACGUUCUUCGCCGAGAGUCGUCGGGGUUUCCUGCUUCAACAGUGCUUGGAC`
`8`	`GGAACCCGGCGCUCGUUCCCCACCCCGGCCGGCCGCCCAUAGCCAGCCCUCCGUCACCUC`
`9`	`UUCACCGCACCCUCGGACUGCCCCAAGGCCCCCGCCGCCGCUCCAGCGCCGCGCAGCCAC`
`10`	`CGCCGCCGCCGCCGCCUCUCCUUAGUCGCCGCC"/>`
`11`	`<param name="structureDBN1" value="...(((............(((.(((((((..((((.(.(((((......))))))))))))))))))))`
`12`	`...........((((((((.((.........((..((((....................))))..)).....(((...(((.((.((..`
`13`	`..)))).)))..)))...)).))))..))))..........)))......"/>`
`14`	`<param name="title1" value="1 human ferritin 5'" />`
`15`	`<param name="warning1" value="true" />`
`16`	`<param name="background1" value="#FFFFEE" />`
`17`	`<param name="modifiable1" value="false" />`
`18`	`<param name="sequenceDBN2" value="CAGACGUUCUCGCCCAGAGUCGCCGCGGUUUCCUGCUUCAACAGUGCUUGAACGG`
`19`	`AACCCGGUGCUCGACCCCUCCGACCCCCGCCGGCCGCUUCGAGCCUGAGCCCUUUGCAAC`
`20`	`UUCGUCGUUCCGCCGCUCCAGCGUCGCCACCGCGCCUCGCCCCGCCGCCACC"/>`
`21`	`<param name="structureDBN2" value="..((((........(((((..((((.((((.((.(.(((((......))))))))))))))))((((((.....(((........))).....))))))..`
`22`	`.....)))))......)))).....((.((....(((..((......))..)))...)).))...."/>`
`23`	`<param name="title2" value="2 mouse ferritin 5'" />`
`24`	`<param name="warning2" value="false" />`
`25`	`<param name="background2" value="#FFEEFF" />`
`26`	`<param name="modifiable2" value="true" />`
`27`	`<param name="basesStyle0" value="basesInnerColor=#0000FF" />`
`28`	`<param name="basesStyle1" value="basesInnerColor=#FF9966" />`
`29`	`<param name="basesStyle2" value="basesInnerColor=#00CCFF" />`
`30`	`<param name="basesStyle7" value="basesInnerColor=#FF3399" />`
`31`	`<param name="basesStyle11" value="basesInnerColor=#00FF99" />`
`32`	`<param name="applyBasesStyle0on2" value="22, 23, 24, 114, 115, 116" />`
`33`	`<param name="applyBasesStyle1on2" value="27, 28, 29, 30, 67, 68, 69, 70" />`
`34`	`<param name="applyBasesStyle2on1" value="43, 44, 45, 46, 47, 48, 49, 50" />`
`35`	`<param name="applyBasesStyle11on1" value="36, 37, 63, 64" />`
`36`	`<param name="applyBasesStyle7on2" value="39, 40, 61, 62" />`
`37`	`<param name="applyBasesStyle0on2" value="149, 150, 151" />`
`38`	`</applet>`